Acta Scientific Cancer Biology

EditorialVolume 2 Issue 2

Patent Highlights in Cancer Gene Therapy’s

Martin Perez-Santos1,2*

1Oficina de Comercialización de Tecnología, Centro Universitario de Vinculación y Transferencia de Tecnología, Vicerrectoría de Investigación y Estudios de Posgrado, Benemérita Universidad Autónoma de Puebla, México
2Pharma Patent Consultancy, México

*Corresponding Author: Martin Perez-Santos, Oficina de Comercialización de Tecnología, Centro Universitario de Vinculación y Transferencia de Tecnología, Vicerrectoría de Investigación y Estudios de Posgrado, Benemérita Universidad Autónoma de Puebla, Ciudad Universitaria, Puebla, México.

Received: January 23, 2018; Published: January 30, 2018

Citation: Martin Perez-Santos. “Patent Highlights in Cancer Gene Therapy’s”. Acta Scientific Cancer Biology 2.2 (2018).

Abstract

  USA Patent Application US2017275629, Methods and Compositions for the Treatment of Cancer (Inventors: Lieberman J, Gilboa-Geffeb A, Wheeler LA; applicant: Children’s Medical Center Corp., USA; published: September 28, 2017).

  RNA interference offers the opportunity to treat disease, e.g. cancer, by knocking down disease-causing genes. Chimeric aptamer-siRNA molecules target cancer cell markers to direct the siRNA specifically to the cancer cells. The Boston Children's Hospital Center Corp operates as a non-profit organization that offers health care services such as breast cancer, autism, brain injury, cardiac anesthesia, and pediatrician, filed the application underlying this patent disclosure on August 28, 2015. The concept is interesting: a chimeric aptamer-siRNA molecules (AsiCs) comprising a cancer EPCAM-binding aptamer domain (GCGACUGGUUACCCGGUCGUUU) and an inhibitory nucleic acid that inhibits the expression of a gene selected from the group consisting of: Plk1 (NCBI Gene ID: 5347), MCL1 (NCBI Gene ID: 4170), EphA2 (NCBI Gene ID: 1969), PsmA2 (NCBI Gene ID: 5683), MSI1 (NCBI Gene ID: 4440), BMI1 (NCBI Gene ID: 648), XBP1 (NCBI Gene ID: 7494), PRPF8 (NCBI Gene ID: 10594), PFPF38A (NCBI Gene ID: 84950), RBM22 (NCBI Gene ID: 55696), USP39 (NCBI Gene ID: 10713), RAN (NCBI Gene ID: 5901), NUP205 (NCBI Gene ID: 23165), and NDC80 (NCBI Gene ID: 10403). Particularly, EpCAM AsiC targeting PLK1 specifically inhibits cell proliferation in basal A breast cancer cells when the effect of EpCAM-AsiC targeting PLK1 on cell proliferation was tested on 10 breast cancer cell lines representative of basal A, B and luminal cell lines. In addition, EPCAM AsiCs are stable in human serum and do not stimulate innate immunity which allows an increase in administration efficiency and therapeutic efficacy while reducing the potential for side effects.

Copyright: © 2018 Martin Perez-Santos. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.




Metrics

Acceptance rate35%
Acceptance to publication20-30 days
Impact Factor1.183

Indexed In




News and Events


  • Publication Certificate
    Authors will be provided with the Publication Certificate after their successful publication
  • Last Date for submission
    Authors are requested to submit manuscripts on/before July 03, 2026, for the upcoming issue of 2026.

Contact US